Search Result

Pathways Recommended:	Cell Cycle/DNA Damage

Results for "

DNA reduction

" in MedChemExpress (MCE) Product Catalog:

By Targets:	DNA Alkylator/Crosslinker (1) DNA/RNA Synthesis (1) Apoptosis (1) Biochemical Assay Reagents (1) Endogenous Metabolite (1) HBV (3) Isotope-Labeled Compounds (1)
By Research Areas:	Cancer (2) Infection (3) Metabolic Disease (1)

Inhibitors & Agonists

Biochemical Assay Reagents

Natural
Products

Isotope-Labeled Compounds

Targets Recommended: DNA-PK DNA Methyltransferase DNA Stain DNA Alkylator/Crosslinker DNA/RNA Synthesis

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-W011142

2'-Deoxyuridine 5'-monophosphate disodium	Endogenous Metabolite	Metabolic Disease
2'-Deoxyuridine 5'-monophosphate disodium is reductively methylated to dTMP (2'-deoxythymidine 5'-monophosphate) by bisubstrate enzyme thymidylate synthase (TS). dTMP is a nucleotide required for DNA synthesis .

HY-147217A

Bepirovirsen sodium ISIS 505358 sodium	HBV	Infection
Bepirovirsen sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-144319

SHR5133

HBV Infection

SHR5133 is a highly potent, orally active HBV capsid assembly modulator. SHR5133 displays HBV DNA reduction (EC₅₀=26.6 nM) .

SHR5133	HBV	Infection
SHR5133 is a highly potent, orally active HBV capsid assembly modulator. SHR5133 displays HBV DNA reduction (EC₅₀=26.6 nM) .

HY-N0510A

Aristolochic acid sodium salt Aristolochic acid I sodium; TR 1736 sodium; Sodium aristolochate	Biochemical Assay Reagents	Others
Aristolochic acid sodium salt (Sodium aristolate 1) is a component of some Chinese herbal medicines and is responsible for nephrotoxicity. It is a proagent that is activated by reduction of nitro groups to amines, resulting in the formation of cytotoxic DNA adducts.

HY-147217

Bepirovirsen ISIS 505358	HBV	Infection
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .

HY-13543

Tretazicar CB 1954	DNA Alkylator/Crosslinker	Cancer
Tretazicar (CB 1954), an antitumor proagent, is highly selective against the Walker 256 rat tumour line. Tretazicar is enzymatically activated to generate a bifunctional agent, which can form DNA-DNA interstrand cross-links. Tretazicar in rat cells involves the reduction of its 4-nitro group to a 4-hydroxylamine by the enzyme NAD(P)H:quinone oxidoreductase 1 (NQO1) .

HY-W011500

TCEP hydrochloride 4 Publications Verification Tris(2-carboxyethyl)phosphine hydrochloride	Others	Others
TCEP hydrochloride (Tris(2-carboxyethyl)phosphine hydrochloride) is a non-thiol reducing agent that is more stable and produces a faster S-S reductive reaction than other chemical reductants. TCEP hydrochloride is a trialkylphosphine, selectively reduces protein disuldes without altering the properties or interacting with thiol-directed agents in the reaction mixture. TCEP hydrochloride is also a commonly used reducing agent in the DNA/AuNP chemistry .

HY-16350

BOLD-100 NKP-1339; IT-139; KP-1339	DNA/RNA Synthesis Apoptosis	Cancer
BOLD-100 (NKP-1339; IT-139) is the first-in-class ruthenium-based anticancer agent in development against solid cancer with limited side effects. BOLD-100 induces G2/M cell cycle arrest, blockage of DNA synthesis, and induction of apoptosis via the mitochondrial pathway. BOLD-100 has a high tumor targeting potential, strongly binds to serum proteins such as albumin and transferrin and activates in the reductive tumor milieu .

HY-W011500S

TCEP-d16 hydrochloride	Isotope-Labeled Compounds	Others
TCEP-d₁₆ (hydrochloride) is the deuterium labeled TCEP hydrochloride[1]. TCEP hydrochloride (Tris(2-carboxyethyl)phosphine hydrochloride) is a non-thiol reducing agent that is more stable and produces a faster S-S reductive reaction than other chemical reductants. TCEP hydrochloride is a trialkylphosphine, selectively reduces protein disuldes without altering the properties or interacting with thiol-directed agents in the reaction mixture. TCEP hydrochloride is also a commonly used reducing agent in the DNA/AuNP chemistry[2][3][4][5].

Aristolochic acid sodium salt Aristolochic acid I sodium; TR 1736 sodium; Sodium aristolochate	Biochemical Assay Reagents
Aristolochic acid sodium salt (Sodium aristolate 1) is a component of some Chinese herbal medicines and is responsible for nephrotoxicity. It is a proagent that is activated by reduction of nitro groups to amines, resulting in the formation of cytotoxic DNA adducts.

Cat. No.	Product Name	Category	Target	Chemical Structure

HY-W011142

2'-Deoxyuridine 5'-monophosphate disodium	Natural Products Classification of Application Fields Source classification Metabolic Disease Endogenous metabolite Disease Research Fields	Endogenous Metabolite
2'-Deoxyuridine 5'-monophosphate disodium is reductively methylated to dTMP (2'-deoxythymidine 5'-monophosphate) by bisubstrate enzyme thymidylate synthase (TS). dTMP is a nucleotide required for DNA synthesis .

Cat. No.	Product Name	Chemical Structure

HY-W011500S

TCEP-d16 hydrochloride
TCEP-d₁₆ (hydrochloride) is the deuterium labeled TCEP hydrochloride[1]. TCEP hydrochloride (Tris(2-carboxyethyl)phosphine hydrochloride) is a non-thiol reducing agent that is more stable and produces a faster S-S reductive reaction than other chemical reductants. TCEP hydrochloride is a trialkylphosphine, selectively reduces protein disuldes without altering the properties or interacting with thiol-directed agents in the reaction mixture. TCEP hydrochloride is also a commonly used reducing agent in the DNA/AuNP chemistry[2][3][4][5].

TCEP-d16 hydrochloride

TCEP-d₁₆ (hydrochloride) is the deuterium labeled TCEP hydrochloride[1]. TCEP hydrochloride (Tris(2-carboxyethyl)phosphine hydrochloride) is a non-thiol reducing agent that is more stable and produces a faster S-S reductive reaction than other chemical reductants. TCEP hydrochloride is a trialkylphosphine, selectively reduces protein disuldes without altering the properties or interacting with thiol-directed agents in the reaction mixture. TCEP hydrochloride is also a commonly used reducing agent in the DNA/AuNP chemistry[2][3][4][5].

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks